Key words repeated implantation failure - embryo implantation - tacrolimus - immune system -
assisted reproductive technology (ART) - intracytoplasmic sperm injection (ICSI) -
in vitro fertilization (IVF) - leukemia inhibitory factor (LIF) - interleukin (IL)-4,
IL-10, IL-17 - interferon gamma (IFN-γ)
Schlüsselwörter wiederholtes Implantationsversagen - Embryotransfer - Tacrolimus - Immunsystem - assistierte
Reproduktionstechnologie (ART) - intrazytoplasmatische Spermieninjektion (ICSI) -
In-vitro-Fertilisation (IVF) - leukämiehemmender Faktor (LIF) - Interleukin (IL)-4,
IL-10, IL-17 - Interferon gamma (IFN-γ)
Introduction
While assisted reproductive technology (ART) has made considerable advances in the
decades since its inception, the current success rate is still under 30% [1 ] and implantation failure remains a significant obstacle [2 ]. Repeated implantation failure (RIF) is diagnosed when a woman under the age of
40 is unable to achieve a pregnancy after the transfer of at least three good-quality
embryos over a minimum of three fresh or frozen cycles [3 ]. Dysregulation of the endometrial immune profile results in a decrease in endometrial
receptivity and is thought to be responsible for the failure of embryo implantation
[2 ], [4 ], [5 ]. It has been reported that endometrial immune profiles appear to be dysregulated
in 81.7% of RIF patients. Studies have demonstrated an overactivation of the immune
system
in 56.6% and low activation in 25% of RIF patients [2 ]. Thus, resolving this mechanism may improve the success rates for RIF patients.
During the window of implantation (WOI), a massive influx of immune cells induces
maternal immune tolerance to protect the embryo from rejection [6 ]. Immune cells such as T-helper cells (Th1, Th2, and Th17) and regulatory T-cells
(Treg) contribute to maternal immune tolerance and the precise balance of cytokine
signals needed to maintain pregnancy [7 ]. Th1 cells, which contribute to cell-mediated immunity, produce inflammatory cytokines
such as interleukin-2 (IL-2), interferon gamma (IFN-γ), and tumor necrosis factor-alpha
(TNF-α), while Th2 cells are a source of anti-inflammatory cytokines such as IL-4
and IL-10 which contribute to humoral responses. Successful implantation shifts the
response of the endometrial lining from a cell-mediated to a humoral response, but
an imbalance between Th1 and Th2 cells and their cytokines can result in implantation
failure [4 ]. Pro- and
anti-inflammatory cytokine ratios in peripheral blood which reflect the Th1/Th2
ratio (e.g., IFN-γ/IL-4 and IFN-γ/IL-10) are significantly higher in RIF patients
compared to fertile controls [4 ], [8 ], [9 ]. Th2 cytokines such as IL-4 can induce the expression of leukemia inhibitory factor
(LIF) [10 ], a pro-inflammatory cytokine essential for blastocyst implantation and stromal decidualization
[11 ]. The tumor suppressor p53 plays a crucial role in maintaining genomic stability
and for tumor prevention [12 ]. Furthermore, p53 plays a role regulating maternal reproduction through regulation
of LIF gene expression [13 ]. An embryo carries both paternal and maternal antigens, and embryo implantation
is considered an allograft [14 ].
It has been proved that Th17 cells contribute to allograft rejection [15 ], [16 ], and it has been demonstrated that the RIF mechanism is similar to that of allograft
rejection. During the transient immune switch, 65 – 70% of the immune cells are uterine
natural killer (uNK) cells in the endometrium that belong to the innate immunity compartment
[17 ]. The activation of these cells plays a fundamental role in Th2 cytokine production
and the establishment of local maternal tolerance [18 ]. Interestingly, it has been demonstrated that the endometrium of women with RIF
contains abnormal levels of uNK cells [19 ]. Regulation of the immune system by therapeutic agents may improve implantation
and pregnancy rates in women with a history of RIF. Nakagawa et al. [4 ], [8 ] demonstrated that when RIF patients with an elevated Th1/Th2 ratio were treated
with tacrolimus, an immune-suppressive agent, the pregnancy rate increased significantly
compared to a non-treated group. Tacrolimus is a T-cell-specific, anti-inflammatory
agent [20 ] that suppresses the immunological rejection of an allograft and promotes its survival
by inhibiting lymphocyte proliferation [21 ]. Moreover, it has been documented that tacrolimus inhibits the transcription and
release of both Th1 and Th2 cytokines, such as IL-2, IL-4, IL-5, IFN-γ, and TNF-α
[22 ], but primarily suppresses Th1 cells [8 ]. Tacrolimus can also inhibit the expression of IL-17 and induce the expression of
both p53 and LIF, reducing allograft rejection [15 ], [16 ], [22 ], [23 ], [24 ], [25 ], [26 ].
Given the involvement of tacrolimus in immune regulation, we investigated the effect
of tacrolimus treatment on endometrial immune response, as well as endometrial receptivity
markers in RIF patients. To do this, we evaluated protein and mRNA expression of p53,
LIF, IL-4, IL-10, IL-17, and IFN-γ in the endometrium of RIF patients with and without
tacrolimus treatment and also investigated the association between these factors and
ART outcomes. To our knowledge, this is the first study to investigate the effects
of tacrolimus on the cytokine expression profile and endometrial receptivity markers
in RIF patients.
Materials and Methods
The study was carried out at the Infertility and IVF division of AL-Zahra Hospital
at the Tabriz University of Medical Sciences in Tabriz, Iran from May 2017 to December
2018 in collaboration with the Department of Reproductive Biology at the Shahid Beheshti
University of Medical Sciences in Tehran, Iran. This study was approved by the Research
Ethics Committee of the Shahid Beheshti University of Medical Sciences (approval code:
IR. SBMU. MSP.REC.1395.580). The study was carried out in accordance with the Code
of Ethics of the World Medical Association (Declaration of Helsinki), and a signed
informed consent form was obtained from all patients prior to entering the study.
The study has been registered in the Iranian Registry of Clinical Trials (https://www.irct.ir ; Registry code: IRCT20171007036623N1).
Study population
Ten women diagnosed with RIF and eligible for intracytoplasmic sperm injection (ICIS)/embryo
transfer (ET), were selected for participation. Each participant also had a history
of three or more failed ART cycles with morphologically good-quality embryos. Patients
were assessed by transvaginal ultrasound, hysterosalpingography, and hysteroscopy
before they were entered in the study to exclude patients with submucosal fibroids,
endometrial polyps, intrauterine adhesions, congenital anomalies of the uterus, and/or
hydrosalpinges. Furthermore, none of the participants had any history of autoimmune
disease. Women with a history of chronic inflammatory conditions, acquired or inherited
thrombophilia, previous immunotherapy, previous miscarriage, irregular menstrual cycles,
or who were vaccinated in the last three months were excluded from the study. To determine
the presence of immunological disorders, IFN-γ and IL-4 levels were measured on days
5 – 10 of the menstrual cycle
and an IFN-γ/IL-4 ratio ≥ 10.3 was classified as an elevated Th1/Th2 ratio [4 ]. These patients were recruited into the study. A schema of the in-vivo study design
is presented in [Fig. 1 ].
Fig. 1 Schema of the in-vivo study design. RIF: repeated implantation failure, IFN-γ: interferon
gamma, IL: interleukin, LH: luteinizing hormone, LIF: leukemia inhibitory factor.
To determine the baseline Th1/Th2 ratio, 10 mL of venous blood was collected into
sodium heparinized tubes on days 5 – 10 of the menstrual cycle. Th1 and Th2 cells
were determined by detecting intracellular interferon (IFN)-γ and IL-4 production.
Peripheral blood mononuclear cells (PBMCs) were isolated from blood samples by adding
1.077 g/mL of ficoll (Lymphosep, Biosera, UK) followed by centrifugation. Before flow
cytometry, samples were incubated with 10 ng/mL of phorbol 12-myristate 13-acetate
(PMA) and 0.5 mM ionomycin at 37 °C in a 5% CO2 humidified incubator for 5 h. Chemical stimulators such as monensin (eBioscience,
San Diego, CA, USA) were used to improve the staining of intracellular cytokines.
Before staining, cells were washed and incubated with monoclonal antibodies including
anti-CD4-APC (BD Biosciences), fluorescein isothiocyanate (FITC)-labeled anti-IFN-γ
(Becton Dickinson, Franklin Lakes, NJ, USA), and anti-IL-4-phycoerythrin (PE) (Becton
Dickinson). Th1 and Th2 cells were detected among PBMCs using the BD FACSCalibur™ flow cytometer (San Jose, CA, USA). Th1 cells were defined as CD4+ lymphocytes with
intracellular IFN-γ but without IL-4. Th2 cells were detected as CD4+ lymphocytes
with intracellular IL-4 but without IFN-γ. The ratio of IFN-γ to IL-4 positive Th cells
was expressed as the Th1/Th2 ratio.
Controlled ovarian stimulation and embryo transfer (ET)
Applied ovarian stimulation was completed as follows: According to the age and ovarian
reserve of patients, 150 – 225 IU of rFSH (Gonal-F, Merck Serono, Tokyo, Japan) was
administered on day 2 or 3 of the menstrual cycle. Follicular growth was assessed
by transvaginal sonography. When follicles reached 12 – 13 mm in diameter, 0.25 mg/day
of GnRH antagonist (Cetrotide, Merck Serono, Darmstadt, Germany) and 75 IU/day of
human menopausal gonadotropin ([hMG], Menopur, Ferring, Switzerland) was administered
until at least one follicle reached a diameter of 17 – 18 mm. At this point, 10 000 IU
hCG (Pregnyl, Merck Serono) was injected and ovum pick-up (OPU) was performed 34 – 36
hours later. Intracytoplasmic sperm injection (ICSI) was utilized for all patients.
For luteal phase support, hormone replacement cycle (HRC) was used, starting with
the administration of an oral contraceptive (Ovocept-HD, Abureihan Co., Iran) and
a GnRH agonist (Diphereline 3.75 mg, Ipsen, France), and
in the next cycle, treatment was continued with conjugated estrogens (1.25 mg
equilenin, Grupo Ferrer Internacional SA, Spain) until an appropriate endometrial
thickness was achieved (at least 7 mm under transvaginal sonography). Frozen ET was
performed on day 19 – 21 of the menstrual cycle and all patients received two morphologically
good quality blastocysts. From the day of ET until pregnancy testing, patients were
treated with Cyclogest® (400 mg pessary, Actoverco, Karaj, Iran). A biochemical pregnancy test was performed
14 days after ET. Clinical pregnancy was recognized when the development of a gestational
sac was detected on transvaginal ultrasound 21 days after ET. Ongoing pregnancy was
recognized when a normal fetus was seen on transvaginal ultrasound at 12 weeks of
gestation. The primary and secondary endpoints were clinical pregnancy and ongoing
pregnancy, respectively.
Tacrolimus treatment
Patients were treated with two cycles of tacrolimus (Prograf, Astellas Pharma Ltd,
Staines, UK), one for the endometrial biopsy (second endometrial biopsy) and one for
the embryo transfer. In the first treatment cycle, patients were treated with tacrolimus
for 16 days before undergoing endometrial biopsy. Similarly, in the second treatment
cycle, we administrated tacrolimus for 16 days (two days before ET and up to 14 days
after ET). The daily dosage of tacrolimus was 1 – 3 mg, depending on the degree of
Th1/Th2 elevation; patients with a mild increase in the Th1/Th2 ratio (≥ 10.3 and
< 13.0) were treated with 1 mg of tacrolimus, patients with a moderate increase in
the Th1/Th2 ratio (≥ 13.0 and < 15.8) were treated with 2 mg of tacrolimus, and patients
with high increase in the Th1/Th2 ratio (≥ 15.8) were treated with 3 mg of tacrolimus.
Steroid hormone evaluation
Serum estradiol and progesterone were evaluated using commercial ELISA kits (MyBioSource,
San Diego, USA) according to the manufacturerʼs instructions. Both hormones were analyzed
in cycles with and without tacrolimus treatment 7 to 9 days after the LH surge.
Endometrial biopsy
The endometrium was gently aspirated by rotating a Pipelle de Cornier (Laboratoire
CCD, Paris, France) in the endometrial cavity during the window of implantation (LH + 7
to LH + 9) in two different consecutive cycles. The Pipelle contents were emptied
onto a gauze compress and divided into two parts, one of which was placed in 4% formaldehyde
for routine evaluation, endometrial dating, and CD56 immunolabeling. The second part
was placed in RNAlater™ stabilization solution for molecular analysis. A urinary LH kit (Abon Biopharma Company,
China) was used to determine the day of the LH surge. Twenty samples of endometrial
tissue from 10 patients were obtained in two subsequent menstrual cycles with and
without tacrolimus treatment. The first biopsy was done in a cycle without treatment
and the other biopsy in a second cycle with tacrolimus treatment. Samples were histologically
assessed to match the secretory phase based on the appearance of tortuous glands,
enlarged stromal cells, and the presence of subnuclear cytoplasmic glycogen vacuoles
in the lumen of the glands. Data from one patient was excluded due to non-histocompatibility
with secretory phase features. Endometrial samples were used to evaluate the protein
and mRNA levels of cytokines using immunohistochemistry and real time-PCR techniques,
respectively.
mRNA expression of p53, LIF, IL-4, IL-10, IL-17, and IFN-γ
Total RNA was extracted from 20 endometrial tissues obtained from ten RIF patients
using an RNeasy Plus Kit (QIAGEN, USA) according to the manufacturerʼs instructions.
The concentration of each RNA sample was measured using a NanoDrop 2000 Spectrophotometer
(ND-1000, NanoDrop technology, Australia). Complementary DNA (cDNA) was synthesized
using a PrimerScript RT reagent kit (Takara Bio, Otsu, Japan). SYBR Green was employed
for the analysis of p53, LIF, IL-4, IL-10, IL-17, and IFN-γ expression. Sequences
of the study primer sequences are summarized in [Table 1 ]. In the PCR program, after 2 min at 50 °C and 2 min at 95 °C as an activation step,
40 cycles comprised of 15 s denaturation at 95 °C, 15 s annealing at 60 °C, and extension
at 72 °C for 1 min were performed using a StepOnePlus real-time PCR system (Applied
Biosystems, Fisher Scientific, US). Gene expression was analyzed by comparison to
a reference gene in each PCR run. Relative
gene expression levels were calculated using the 2-ΔΔCt method and expressed as a fold change of the control sample. All reactions were performed
in triplicate.
Table 1 Primer sequences for real-time PCR.
Sequence (5′ → 3′)
TM (°C)
Product size (bp)
LIF: leukemia inhibitory factor, IL-10: interleukin-10, IL-17: interleukin-17, IL-4:
interleukin-4, IFN-γ: interferon gamma, β-actin: beta-actin
TP53
Forward
AGCCACATTCTAGGTAGGGGC
61.78
130
Reverse
TGCACTCTGTGAGGTAGGTGC
61.78
LIF
Forward
GAAGCTGGGCTGTCAACTCCT
61.78
99
Reverse
CCTCGGTTCACAGCACACTTC
61.78
IL-10
Forward
TCCCCTAACCTCATTCCCCAA
59.82
90
Reverse
GCCCGGCCTAGAACCAAATTT
59.82
IL-17
Forward
CCGGCTGGAGAAGATACTGGT
61.78
126
Reverse
CTGGGTCGGCTCTCCATAGTC
63.73
IL-4
Forward
GCTGATCCGATTCCTGAAA
54.51
89
Reverse
TACTCTGGTTGGCTTCCT
53.69
IFN-γ
Forward
CTTTAAAGATGACCAGAGCATCCA
59.30
94
Reverse
ATCTCGTTTCTTTTTGTTGCTATTGA
56.92
β-actin
Forward
GCATGGGTCAGAAGGATTCCT
61.88
106
Reverse
TCGTCCCAGTTGGTGACG
61.83
Protein expression of LIF, IL-4, IL-10, IL-17, and IFN-γ
One part of the endometrial biopsies was immediately placed into 10% neutral buffered
formalin for overnight fixation and then embedded in paraffin wax. LIF, IFN-γ, IL-4,
IL-10, and IL-17 protein expression as well as CD56+ cells (uNK cells) were determined
using fluorescent immunohistochemistry. Endometrial sections with a thickness of 5 µm
were fixed with 4% paraformaldehyde in PBS (pH 7.4) for 20 min and permeabilized by
0.3% Triton X100 for 30 min and blocked in 10% normal goat serum in phosphate-buffered
saline (PBS) for 1 h at room temperature. Samples were incubated overnight at 4 °C
with the corresponding primary antibodies for LIF (ab113262, Abcam, Cambridge, UK),
IFN-γ (ab25101, Abcam), IL-4 (ab2503, Abcam), IL-10 (ab34843, Abcam), and IL-17 (ab79056,
Abcam) diluted in PBS. Samples were then incubated with FITC-conjugated secondary
antibody (ab6717, Abcam) diluted with PBS at room temperature and kept in the dark
for 1 h. Sections were subsequently mounted with
4′6-diamidino-2′-phenylindole dihydrochloride (DAPI, Roche Diagnostics, Germany)
to stain the nuclei and preserve fluorescence signals. Fluorescent signals were analyzed
with fluorescence microscopy (Olympus BX51, Olympus Optical Co., Tokyo, Japan). For
each patient, endometrial tissue samples were analyzed in triplicate. Triplicate tissue
was a serial section from the same paraffin tissue block. All samples were imaged
using a 400× objective lens.
Immunohistochemistry of uterine NK cells
Immunohistochemistry (IHC) with pre-diluted anti-CD56 (clone 123C3) mouse monoclonal
primary antibody (Ventana Medical Systems, Roche Diagnostics, Germany) was performed
on twenty endometrial biopsies obtained from ten RIF patients to detect uterine NK
cells (uNKs). CD56-positive cells were counted per one mm2 of the tissue slide. Images were taken and prepared with an on-board camera (Cyber-Shot,
Zeiss, Japan). Scale bars were produced using a morphometric lens (CH-2, Olympus,
Germany) and proofed with Meazure software (C Thing Software, Sunnyvale, CA, USA).
All images were captured under 100 × magnification. Pixel-based frequency values were
obtained using Image-Pro-insight software (Version 9.0, Media Cybernetics, USA).
Statistical analysis
Statistical analysis was performed using SPSS-PC statistics software (version 23;
SPSS Inc., Chicago, IL, USA). Since the study data were normally distributed, paired
t-test and studentʼs t-test were applied to compare data before and after tacrolimus
treatment and between pregnant and non-pregnant patients, respectively. Because of
the normality of distribution, we used Pearson or Spearman tests to evaluate correlation.
A p-value < 0.05 was considered statistically significant.
Results
Patient hormone levels
Estradiol and progesterone levels in peripheral blood were measured on days 7 – 9
after the LH surge in cycles with and without tacrolimus treatment. Both estradiol
(125.70 ± 74.13 vs. 117.46 ± 91.86 pg/ml, p = 0.84) and progesterone (5.21 ± 3.29
vs. 3.90 ± 2.58 ng/ml, p = 0.36) were lower in the cycle with tacrolimus treatment
compared to the cycle without tacrolimus. However, the differences did not reach statistical
significance.
mRNA and protein expression of endometrial markers in endometrial samples
The expression of IL-4, IL-10, IL-17, IFN-γ, LIF, and p53 mRNA in the endometrial
samples was not statistically different with and without tacrolimus treatment ([Fig. 2 a ]). Although the expression of IL-10, IL-17, and p53 decreased following tacrolimus
treatment, statistical significance was not reached (p > 0.05). The expression ratios
of IFN-γ/IL-4 and IFN-γ/IL-10 also did not show a significant change following tacrolimus
treatment (p > 0.05, [Fig. 2 a ]).
Fig. 2 p53, LIF, IL-10, IL-17, IL-4, and IFN-γ, mRNA (a ) and protein (b ) levels in the endometrial tissue of women with RIF with and without tacrolimus treatment.
Fluorescent immunohistochemistry was conducted using primary antibodies against IL-4,
IL-10, and IL-17, IFN-γ, LIF, and fluorescein isothiocyanate-conjugated secondary
antibody. Nuclei are stained with DAPI. All images were captured under 400 × magnification.
LIF: leukemia inhibitory factor, IL: interleukin, IFN-γ: interferon gamma. The nuclei
are shown in blue (stained with DAPI) and the evaluated factors in green (fluorescence
signals). * = Statistically different in compared to without treatment group.
In the cycle without tacrolimus treatment, positive correlations were found between
p53 and LIF, IL-10, IL-17, IFN-γ, and the IFN-γ/IL-4 ratio (rs = 0.793, 0.794, 0.937, 0.694, and 0.772, respectively). LIF mRNA was positively correlated
with IL-10 and IL-17 expression (rs = 0.716 and 0.896, respectively). Furthermore, IL-10 expression showed positive correlations
with IL-17 and IFN-γ expression as well as with the IFN-γ/IL-4 ratio in the cycle
without tacrolimus treatment (rs = 0.872, 0.816, and 0.857, respectively). IL-17 expression was positively correlated
with the IFN-γ/IL-4 ratio (p = 0.032 and rs = 0.712). In the cycle with tacrolimus treatment, we observed positive correlations
between p53 and LIF and IL-17 expression (rs = 0.972 and 0.885, respectively). IL-4 was significantly correlated with IFN-γ in
the treated cycle (rs = 0.812).
Protein expressions of endometrial IL-4, IL-10, IL-17, IFN-γ, and LIF in the cycles
with and without tacrolimus treatment are illustrated in [Fig. 2 b ]. Significant decreases in IL-4 and IFN-γ protein, as well as a decrease in the IFN-γ/IL-10
ratio, were observed following tacrolimus administration (p < 0.05). IL-10, IL-17,
and LIF protein were significantly higher in the endometrial tissues treated with
tacrolimus than those without treatment (p < 0.05, [Fig. 2 b ]).
Without tacrolimus treatment, a negative correlation was found between IL-10 and the
IFN-γ/IL-10 ratio (rs = − 0.875). Also, IFN-γ protein was positively correlated with IFN-γ/IL-4 and IFN-γ/IL-10
ratios (rs = 0.851 and 0.795, respectively). Similarly, with tacrolimus treatment, a negative
correlation between IL-10 and the IFN-γ/IL-10 ratio (rs = − 0.718) was observed, while positive correlations between IFN-γ and the IFN-γ/IL-4
and IFN-γ/IL-10 ratios were observed (rs = 0.835 and 0.866, respectively).
Protein and mRNA levels of endometrial markers in pregnant and non-pregnant women
Cytokine mRNA and protein levels were compared in pregnant and non-pregnant women
([Fig. 3 a ] and [b ], respectively). There was no significant difference in mRNA ([Fig. 3 a ]) and protein ([Fig. 3 b ]) expression between pregnant and non-pregnant women with tacrolimus treatment (p > 0.05).
Fig. 3 p53, LIF, IL-10, IL-17, IL-4, and IFN-γ, mRNA (a ) and protein (b ) levels in the endometrial tissue of pregnant and non-pregnant women with RIF who
had tacrolimus treatment. LIF: leukemia inhibitory factor, IL: interleukin, IFN-γ:
interferon gamma.
We also compared mRNA and protein levels in the previous cycle (without tacrolimus
treatment) in pregnant and non-pregnant participants. The mRNA expression of IL-4
and IFN-γ was significantly higher in the endometrial tissue of pregnant compared
to non-pregnant women in the cycle without treatment (p = 0.03 and 0.05, respectively).
Protein levels did not show any significant difference between pregnant and non-pregnant
patients.
The mRNA expression of IL-4, IL-10, IL-17, IFN-γ, LIF, and p53, as well as the IFN-γ/IL-4
and IFN-γ/IL-10 ratios in endometrial tissues on days 7 – 9 after the LH surge did
not have a significant association with the implantation rate ([Table 2 ]). However, there was a significant positive correlation between IL-10 protein levels
and implantation rates (p = 0.03, [Table 2 ]).
Table 2 Association between embryo implantation rate and cytokine mRNA and protein levels
with tacrolimus treatment.
p53
LIF
IL-4
IL-10
IL-17
IFN-γ
IFN-γ/IL-4
IFN-γ/IL-10
rs : Spearmanʼs correlation coefficient, LIF: leukemia inhibitory factor, IL: interleukin,
IFN-γ: interferon gamma
Embryo implantation rate
mRNA levels
rs = − 0.351
p = 0.394
rs = − 0.169
p = 0.688
rs = − 0.365
p = 0.374
rs = − 0.052
p = 0.902
rs = 0.266
p = 0.524
rs = − 0.240
p = 0.568
rs = − 0.128
p = 0.762
rs = − 0.247
p = 0.556
Protein levels
–
rs = 0.341
p = 0.409
rs = − 0.323
p = 0.436
rs = 0.735
p = 0.038
rs = 0.048
p = 0.910
rs = − 0.219
p = 0.602
rs = − 0.115
p = 0.786
rs = − 0.537
p = 0.170
Tacrolimus treatment improved RIF patient outcomes
Embryo transfer was carried out in ten patients who received tacrolimus. The treatment
resulted in an implantation rate of 40%, a clinical pregnancy rate of 50% and a live
birth rate of 35% in RIF patients with elevated Th1/Th2 ratios who had previously
failed to become pregnant after at least three separate embryo transfers.
Effect of tacrolimus on uNK in endometrial tissue
The number of uNK cells was higher in the cycle without tacrolimus treatment compared
to the cycle with tacrolimus; however, this difference did not reach statistical significance
(p = 0.06, [Fig. 4 a ]). We did not find a difference in uNK cell counts between pregnant and non-pregnant
women (p > 0.05, [Fig. 4 b ]).
Fig. 4 Number of uterine natural killer cells (uNKs) in the endometrial tissue of women
with RIF. a uNKs in the endometrial tissues with and without tacrolimus treatment. b uNKs in the endometrial tissues of pregnant and non-pregnant women receiving tacrolimus
treatment. Immunohistochemistry staining for CD56+ (a marker of uNKs) allowed for
counting per one mm2 of the tissue slide. Scale bars were produced using a morphometric lens (CH-2, Olympus,
Germany) and proofed with Meazure software. All images were captured under 100 × magnification.
Discussion
Given the ability of tacrolimus to increase implantation and pregnancy rates in RIF
patients with an elevated Th1/Th2 ratio [4 ], [8 ], the effects of tacrolimus administration on the expression of endometrial factors
(p53, LIF, IFN-γ, IL-4, IL-10, and IL-17) were assessed along with ART outcomes in
RIF patients. The in-vitro expression of these factors in human endometrial epithelium
cells (EECs) and endometrial stromal cells (ESCs) after treatment with different doses
of tacrolimus was also assessed.
Endometrial LIF protein levels increased significantly after treatment with tacrolimus.
To the best of our knowledge, this is the first description of the effect of tacrolimus
on LIF. LIF is a critical parameter in embryonic development and implantation [27 ], [28 ], trophoblast growth and differentiation [29 ], [30 ], luminal epithelial pinopode formation [31 ], and extravillous trophoblast (EVT) invasion [32 ]. Moreover, LIF enhances decidualization of stromal cells [33 ] and contributes to the blastocyst hatching process [34 ], [35 ]. The role of LIF in maternal immune tolerance during pregnancy through the regulation
of human leukocyte antigen G (HLA-G) [36 ], which
suppresses immune reactions and re-modulates spiral arteries by changing cytokine
secretion, consequently facilitates embryo implantation and pregnancy [37 ]. HLA-G is also involved in establishing a balance between Th1 and Th2 cells that
is important for a successful pregnancy [38 ]. Our data also showed that the mRNA expression of LIF in the pregnant group was
higher compared to the non-pregnant group in both tacrolimus treated and non-treated
cycles, demonstrating the importance of LIF for endometrial receptivity and embryo
implantation. Higher levels of LIF expression were observed in the endometrial tissue
of pregnant compared to non-pregnant women during the WOI, and tacrolimus appeared
to have a stimulatory effect. Therefore, tacrolimus may improve implantation via the
induction of LIF. However, LIF protein levels were lower in pregnant women compared
to non-pregnant women, which could be due to the high
rate of LIF secretion into the uterine lumen [39 ], [40 ].
During pregnancy, the maternal immune system shifts toward the production of Th2-type
cytokines such as IL-10 [2 ], [41 ] in both the maternal circulation and the endometrium. IL-10 plays an important role
in maternal immune tolerance [42 ], [43 ] via several mechanisms, including the inhibition of pro-inflammatory Th1-type cytokines
(e.g. IFN-γ), macrophage production [44 ], [45 ], upregulation of soluble HLA-G [46 ], and the induction of angiogenesis and placental growth [2 ]. Interestingly, we found that tacrolimus treatment significantly increased endometrial
IL-10, which can improve maternal immune tolerance and the chances of implantation.
There are several studies demonstrating elevated IL-10 levels after treatment with
immunosuppressant agents such as tacrolimus [47 ], [48 ], [49 ].
The role of IL-17 in embryo implantation has not yet been determined. However, due
to its pro-inflammatory properties [50 ], it may have a role in embryo rejection. Since embryo implantation is a semi-allograft,
implantation failure may be similar to organ transplant rejection, in which IL-17
plays an important role [15 ], [16 ]. On the other hand, IL-17 may pave the way for implantation and pregnancy by inducing
angiogenesis [51 ] and progesterone secretion [52 ]. We found that tacrolimus significantly increased IL-17 protein levels in the endometrium.
However, other studies have reported that tacrolimus and other immunosuppressive agents
such as cyclosporine A may decrease IL-17 levels in peripheral blood [20 ], [53 ], [54 ], [55 ]. There are no previous reports of the effect of tacrolimus on IL-17 in the endometrium.
Interestingly, we found respectively higher and lower mRNA and protein levels of IL-17
in the pregnant group compared to the non-pregnant group, which may be due to the
high degradation rate of IL-17 protein in a receptive endometrium or the high rate
of IL-17 secretion by the endometrial cells of a receptive uterus. In the present
study, both treated and non-treated cycles showed a strong positive correlation between
IL-17 and LIF, an important receptivity marker, indicating a positive association
between IL-17 and endometrial receptivity. Thus, upregulation of IL-17 following tacrolimus
administration in RIF patients could improve endometrial receptivity and, consequently,
implantation.
Elevated levels of Th2 cytokines lead to successful implantation, whereas a Th1-dominant
environment causes implantation failure [41 ]. Our study showed that the protein levels of both IL-4 and IFN-γ (Th1-related cytokines)
significantly decreased following tacrolimus administration. Furthermore, tacrolimus
reduced IFN-γ/IL-4 and IFN-γ/IL-10 ratios, favoring embryo implantation in RIF patients.
These findings are aligned with those of other studies which reported an inhibitory
effect of tacrolimus on Th1 cytokines [56 ], [57 ]. In accordance with our results, Nakagawa et al. [8 ] also stated that tacrolimus could suppress Th1 but not Th2 cells in the uterus.
Since we found that in the non-treated cycles the IFN-γ/IL-4 and IFN-γ/IL-10 ratios
were lower in the pregnant group compared to the non-pregnant group, RIF patients
with a low Th1/Th2 ratio may be
good candidates for tacrolimus therapy. According to our results, patients with
low ratios had better outcomes while tacrolimus was less effective in patients with
higher ratios. However, further studies with larger sample sizes are required to define
a cut-off value for the ratio as an index figure for tacrolimus therapy.
uNKs are also necessary for the establishment of local maternal tolerance and the
survival of the fetus [2 ]. These cells are different from blood NKs as they have no cytotoxicity potential.
uNKs play important roles in the production of Th2 cytokines [18 ], angiogenic factors, and spiral artery remodeling [58 ], [59 ]. We observed that in the cycle before treatment with tacrolimus, levels of uNKs
were higher in the pregnant group compared to the non-pregnant group, hinting at the
importance of these cells in endometrial receptivity. The number of uNKs decreased
after treatment with tacrolimus. Previous studies have also pointed to a reduction
in the number of NKs and the impairment of their function following tacrolimus administration
[60 ], [61 ]. Due to a lack of information about the
effect of tacrolimus and other immunosuppressive agents on uNKs, it is not known
how tacrolimus could decrease the number of uNKs in the endometrium and how such an
inhibitory effect might influence implantation and pregnancy rates. Further studies
are required to clarify whether a reduction in uNK cells results from tacrolimus treatment
and impacts endometrial receptivity and implantation.
To the best of our knowledge, this is the first study to evaluate the effect of tacrolimus
on endometrial receptivity, implantation, and pregnancy outcomes. It should be mentioned
that our findings demonstrated that tacrolimus significantly affects the protein levels
of IL-10, IL-17, and LIF rather than their mRNA expression. There are two possible
explanations for this effect. First, tacrolimus could induce translation of the genes
mRNAs ro stability of their protein. Secondly, we evaluated the percentage of positive
cells for the protein, and it is possible that tacrolimus increases the number of
endometrial cells that express these factors instead of increasing the expression
of the factors in each cell. However, the main limitation of this study is its small
sample size and the unwillingness of patients to undergo two endometrial biopsies.
Further studies with larger sample sizes are required to confirm our findings. Moreover,
more studies are needed to investigate
other immunosuppressive agents such as cyclosporine A or sirolimus and their potential
impact for improving implantation rates in RIF patients.
In conclusion, tacrolimus significantly increased the expression of LIF, IL-10, and
IL-17 and decreased the expression of IL-4, IFN-γ and the IFN-γ/IL-10 ratio in RIF
patients. Tacrolimus treatment led to an implantation rate of 40%, clinical pregnancy
rate of 50% and a live birth rate of 35% in RIF patients with elevated Th1/Th2 ratios
who had previously failed to become pregnant despite at least three transfers of embryos.
Our findings suggest that RIF patients with higher Th1/Th2 ratios could be candidates
for tacrolimus therapy. Furthermore, we found a reduced estradiol and progesterone
serum levels after treatment with tacrolimus, suggesting that luteal phase support
should be considered in the ART cycle of patients receiving tacrolimus.
